SRY Gene - epistatic. Controls 2 other genes.
     1. Testosterone Gene - tells the Adrenal gland to produce a surge of testosterone in the 7th week of enbryonic developement. Causes the formations of the male sexual anatomy.
     2. MIS Gene - produces a protein that stops the formation of female anatomy.

Gene Control (watched video) - the Lac-Operon - is a set of genes found in E Coli that help to breakdown Lactose (milk sugar)

I. Lactose passively diffuses into the cell and bonds to a repressor molecule found on the promotor region (TATA Box) of the operon. Lactose is the inducer.

II. This lifts the repressor off of the DNA. Allowing Transcription Factors and RNA Polymerase to start the process of the transcription of 3 genes:
     A. Beta-Galactosidase - breaks the 2 sugars apart.
                                              
                                   Lactose ----------> Glucose and Galactose

     B. Permease - embeds in the cell membrane and provides a passageway for lactose.
     C. Galactose Transferase - converts galactose into glucose.

III. As Lactose is metabolized and becomes low in concentration, the inducer lactose molecules will break off the repressor. Now, the repressor bonds back onto the promotor region and this stops the transcription of the 3 genes.

Dec. 14

2. Turners Syndrome- X0, female, characteristic appearance, low estrogen & progesterone, sterility & decreased femininity.

3. Meta Female- XXX, severe disability

4. Meta Male- Xyy, no effect

IV. Translocation- When one chromosome pulls off a part of another during Meiosis, Result: a piece of a chromosome extra or missing.

SRY Gene- (sex determining region of the Y) epistatic gene that controls two other genes.

1. Testosterone Gene- promotes testosterone release in the 9th week of development, causes male anatomy to form.
2. MIS Gene- stops female anatomy from forming.

December 13

C. Substitution-where one base in DNA is substituted by another. This will probably change one amino acid in the protein. This will either destroy the protein's function (unlikely), keep it the same (likely), slightly hurt the protein's function (likely), or make the protein better (unlikely)-- this is the source of genetic adaptation in a population.

II. Intron/ Exon-changes an intron to an exon or vice-versa-- destroys the protein (probably)

III. Nondisjunction- When the chromosomes do not split apart in anaphase I and/or in anaphase II. Result: Extra DNA or not enough DNA in sperm or egg.
        A. Down Syndrome- Trisomy 21 (3 #21 chromosomes) symptoms: Characteristic Appearance, learning disability. Heart and intestinal defects. Life span approximately 55 years.
        B. Sex Chromosomes: 4
                1. Klinefelter's Syndrome- XXY (XXXY, XXXXY- rare and severe) Male. Characteristic Appearance, no mental disability. Sterile and lessened masculinity--low testosterone.

December 12

III. Translation
A. The mRNA strand will move out into the cytoplasm and bond to the small subunit of a ribosome.

B.ONced this happens, the 1st codon (AUG) will be joined by the first tRNA molecule (transfer) by its anticodon (UAC) and it will bring in the first amino acid-methionine.

C.Now the large subunit of the ribosome will bond on top of the small subunit with teh mRNA strand attached. The large subunit has 3 areas where activity takes place.

       E (Exit)     P (Peptide)     A (Attach)

  The first codon/anticodon is now in the P Site.

D. Now the second tRNA moves in with its amino acid into the A site bringing its amino acid. The bond between the first tRNA and its amino acid will now break and the first peptide bond will now form between the first two amino acids

E. Now the ribosome will sjhift position so that the first codon is in the E site, second in the p site, and third in the A site. The first tRNA will now "exit" the E site (missing its amino acid) The bond between the second tRNA and its amino acid will now break, and a peptide bond will form between the second and third amino acid brought into the A site by the third tRNA.

F. This process continues until the entire length of the mRNA has passed through the ribosome and a STOP codon (UAA, UAG, UGA) is reached. When this happens a release factor moves into the A site and this terminates the polypeptide sequence.

This process is known as THE CENTRAL DOGMA OF BIOLOGY. This is because all life uses the same 20 amino acids to make their proteins, the smae 64 codons to put those amino acids in order, the same chemicals (DNA, mRNA, rRNA, tRNA) to code for and store the information to make proteins.

Mutation- Any change in the DNA molecule.

I. Point Mutations- mutation happens to a small area. (1-2 base pairs of the DNA) inside a gene.
   A. Deletion- one or more base pairs are removed
   B. Addition- one ore more base pairs are added

Protein Synthesis

II. mRNA Processing-the mRNA strand must be prepared to leave the nucleus.
      A. As the mRNA molecule forms a methylated cap is added to the 5' end (head) 
mRNA--CH2-CH2-CH2-......CH2-CH2.
      B. After it's made a poly-A tail is added (chain of Adenine nucleotides) and a series of proteins cover the tail. mRNA--A-A-A-A-A-A....A-A
      C. Splicing- not all mRNA is genetic. Part of it is cut out (Introns) and the rest (Exons) are spliced back together into a single molecule.
   
              Exon      Intron       Exon       Intron       Exon   
Before:  ___________________________________

During:  ___________________________________
                                    0                                    0
After:  _______ ________________________ ______
                        0                                              0


How Translation works:

Protein Synthesis-Transcription/Translation

I. Transcription-Making a copy of the gene.

• The gene is "recognized" by protein transcription factors by a region of the gene upstream from the "recipe" called The Promotor Region - includes a repeat sequence of TATATA....(Also known as the TATA box). These transcription factors will now bond to the promotor region.
• Now, RNA polymerase can bond downstream form the transcription complex and , using ATP as its energy source, it begins to transcribe the gene.

Sequence for board demonstration: TACACCGATTCGCGATAAACCTTAGGCATTACCAGA

December 6, 2012

DNA Replication.
Watch Video.
Helicase seperates DNA to create replication forks.
 Primase create a RNA Primer to create a starting point on the DNA for the Polymerase to start off of.
Polymerase move in a five to three direction. Making one DNA strand separated, RNase H removes the primers, allowing the Polymerase to replace the primer with a strand of DNA.
Polymerase fill in most of the of the gap. Then Ligase come and do the final connection between the DNA strands.
Rnase H aids DNA replication by degrading RNA bound to a DNA template

More detailed notes.


DNA Replication

The Helicase seprates the DNA strand
SSB(not on picture)- Single Strand Bindings Proteins. Hold the 2 strands apart until a new strand can be added.
RNA Primase- Apply a primer which gives a starting point for DNA polymerases. DNA polymerases can not start the process on their own and require a starting point. RNA Primase applies this.
The Difference between the leading strand and the lagging strand is that the Leading strand is one complete strand with one primer. While lagging strand has many primers and is in broken up strands and is not one complete strand.
Okazaki framents- The fragment that includes the primase with the new DNA on the Lagging strand stopping before next strand.
DNA polymerase- Attach onto a primer and adds new DNA nucleotides and an existing strand of DNA.
Rnase H- Removes the RNA Primers. Allowing DNA Polymerase to finish the strands.
Ligase- connects the fragments together